02.08.13

Analyzing the mtDNA of descendants of Richard III’s mother

Posted in 沒有類 / Uncategorized at 09:17

(Followup to my previous post about Richard III’s mtDNA.)

When I posted earlier today, I was aware that Joy and Michael Ibsen who are descendants of Richard III’s mother and who would share the same mtDNA sequence had been tested as being in haplogroup J. At the time, I was unaware of and had not been able to find more details about their DNA tests.

It turns out that some details of Joy Ibsen’s test had been published in the book The Last Days of Richard III by John Ashdown-Hill (Kindle link; hardcover and paperback also available) published in 2010. Helen Riding was kind enough to post the results to facebook:

This isn’t a full sequence, and only a subset of HVR1 and HVR2 were sequenced, but this gets us 682bp of sequence, significantly better than the 53bp we have for Richard III. (There are two sequencing results because it was sequenced twice by separate labs.)

So let’s see what this reveals to us in mthap. First, let’s convert that table to a format usable by mthap and save that to a file:

16069T 16126C
73G 146C 185A 188G 263G 295T 315.1C

Next we’ll again visit the advanced options page because the HVR1 and HVR2 ranges weren’t fully sequenced. This time we want to check HVR1 and enter positions 16020-16390 and check HVR2 and enter positions 58-367. After clicking “Upload” and waiting 10-15 seconds we get this result:

Based on this, Joy Ibsen’s haplogroup is most likely J1c2c. J1c2 is pretty definite. J1c2c is based on optional marker 146C, but since we’re already pretty sure about J1c2, then J1c2c is also a good bet. According to Behar et. al. 2012 the estimated age for this haplogroup is about 4543 years old. J1c2c2 and J1c2c2a are also possibilities but the defining markers are not included in the sequence. (UPDATE 2: J1c2c1 is also possible; see below.) Note that 228A is missing, but it is an optional marker because reversions are very common within J1c.

Now, this isn’t Richard III’s sequence, but I would assume that they wouldn’t be so certain about the DNA matching if they didn’t already know it at least matched this much. Therefore it is likely that Richard III was also J1c2c. We’ll have to wait for more details on his sequence to be released to be sure.

UPDATE: This Science News article also says that Ibsen and the Richard III remains are J1c2c.

UPDATE 2: The above originally omitted J1c2c1 as a possibility due to lack of the 222T marker. Based on Ian Logan’s observations, 222T is an unstable marker prone to reversion, so lack of this marker is not necessarily significant. J1c2c1a would still be excluded.

Analyzing the mtDNA of the presumed Richard III skeleton with mthap

Posted in 遺傳性 / Genetics at 06:44

I thought it would be fun to try analyzing the mtDNA sequence of the presumed Richard III skeleton using my mthap program to see what it comes up with.

Unfortunately, only a 53bp fragment of the ~16569bp mtDNA sequence has been released so far, via this image on the University of Leicester web site:

Richard III mtDNA fragment

(Click for full size.)

This has been transcribed thanks to Ann Turner and Dave Cissell on the ISOGG list as:

CAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGCA

This covers the sequence from positions 16076 to 16127 relative to the rCRS or RSRS reference sequences. (The position numbers on the image are presumably offset due to an earlier insertion.) The only difference to rCRS in the sequence is 16126C. That’s not a lot to work with. Even a basic HVR1 mtDNA test covers over 500 positions sequenced and can still be highly ambiguous. These days a solid haplogroup assignment requires a full sequence, or at least a genotype test covering thousands of markers across the full sequence to get you close (e.g. Genographic 2.0 or 23andMe).

But let’s see how far this gets us anyways.

Published reports indicate that Michael Ibsen, a descendant of Richard III’s mother is in haplogroup J but doesn’t get more specific. 16126C is one of the defining markers for the parent group JT, but it is also found in 11 other haplogroups in the current PhyloTree Build 15 reference. One of the defining markers for J is 16069T, but regrettably the image cuts off just a few bp shy of that marker, so at best this fragment can show JT, but not J.

We’d next want to go through the other 11 possible haplogroups to see which ones fit our fragment and which don’t. In other words, we’d want to look for which of these haplogroups have 16126C but not any other marker in the range of 16076 to 16127. We could do this manually, but that’s what computers are for, so let’s try to do this in an automated way.

I have a web application I’ve written called mthap which is freely available to use for analyzing mtDNA results. The basic version is very easy to use. Just feed it your data file and look at the results. That makes a lot of assumptions though, assumptions which don’t work well with a short fragment like this. Those assumptions are based on the most common DTC mtDNA tests. There’s also the less well known advanced options page where you can twiddle various parameters for unusual cases like this.

Here’s what we need to do:

  1. Make a text file with a text editor such as notepad with this content: 16126C
  2. Select this file on the “File:” line.
  3. Tick the HVR1 option.
  4. Enter 16076 to 16127 as the HVR1 positions.
  5. Click “Upload”

After waiting 10-15 seconds you will see the results. Due to the limitations of this sample, we get a lot of potential matches, but the first four are the most significant: H14b1, HV0a1, R0a, and finally JT. The rest are all either poor matches or subgroups of these. So we’ve managed to reduce our possibilities from 11 to 4, which is not bad. But we’re still left with a good deal of ambiguity. Presumably we will get a full sequence or at least a longer sequence once the scientific journals publish the full articles on the analysis.

UPDATE: See also the followup article: Analyzing the mtDNA of descendants of Richard III’s mother.

(Please note that this is not meant to cast doubt on the identification. It is merely to show how much objective data we can determine based on the currently released information.)

02.11.12

GigaNews == PowerUsenet == usenet.net (and how to access their Hong Kong IP)

Posted in 沒有類 / Uncategorized at 13:35

I’ve been using GigaNews for a while now, mostly because they have a server in Hong Kong which is much, much faster than using US based servers from Taiwan. The downside is that GigaNews is the most expensive service out there with the basic unlimited account going for US$25/month and the top account weighing in at US$35/month. In comparison, most of the other services have unlimited accounts going for US$10-15/month, though sometimes you have to hunt down a coupon to get the best deal. They don’t have all the bells and whistles that GigaNews has, but I don’t use those extra services.

I recently cancelled my GigaNews account to try to find a cheaper service that worked reasonably well. After trying a few different ones, only AstraWeb came anywhere close to reasonable speeds, and even that only used a small fraction of my Internet connection’s max speed.

While exploring the world of Usenet, one thing I found out is that there are really only four usenet services out there currently, and everyone else just resells service from one of them, or is an alternate brand for one of the major providers. So that led me to look at what other names GigaNews is being sold as, and the answer turns out to be PowerUsenet, and usenet.net, both of which have a basic unlimited account for US$15/month and a high end account for US$20/month. UPDATE: Rhino Newsgroups is another, but their retention is fairly limited at 200 days.

I signed up for the basic unlimited account at PowerUsenet and configured my usenet program with the server details… and was immediately disappointed to find that it was connecting to a slow US based server. No problem! GigaNews had a similar issue. They let the DNS server figure out the best IP to use, but it seems to give out the US address sometimes instead of the closer Hong Kong IP address. After some poking around with DNS tools, I was able to figure out the Hong Kong IP address. Once I plugged that in, my usenet client was downloading full speed!

Here for your reference and the Hong Kong usenet server IP addresses:

GigaNews 216.196.97.131
PowerUsenet 203.170.29.161
Rhino Newsgroups 203.170.29.160
usenet.net 203.170.29.171 (UPDATE: Not working as of 2012-09-14.)

Sign up for PowerUsenet through this link and I’ll get a bonus!

08.29.11

Lyrics: Daisy (Danielle Dax)

Posted in 音樂 / Music, 歌詞 / Lyrics at 19:43

This song seems to have been forgotten…

Artist: Danielle Dax
Song: Daisy
Album: Blast The Human Flower

Daisy, I know you didn’t mean it but you got her
Oh honey they say you took along a pistol and you shot her

And now the word is out in town
They will come and drag you down
Take away your pride
Take away your liberty

I will give you sympathy
Anything you want of me
I will give you all of my heart

I will give you sanctuary
Everything is safe with me
You have got a hold of my heart

Daisy, they say they made your life not worth the living
Oh but you took it with dignity and pride you were forgiving

But then she pushed you just too far
Broke through your resolve at last
Something gave inside
Something I’m afraid to see

I will give you sympathy
Anything you want of me
I will give you all of my heart

I will give you sanctuary
Everything is safe with me
You have got a hold of my heart

And the men all search the town
But the fox has gone to ground
And they’ll never settle down
Until they find you

And now the word is out in town
They will come and drag you down
Take away your pride
Take away your liberty

I will give you sympathy
Anything you want of me
I will give you all of my heart

I will give you sanctuary
Everything is safe with me
You have got a hold of my heart

And the men all search the town
But the fox has gone to ground
And they’ll never settle down
Until they find you

I will give you sympathy
Anything you want of me
I will give you all of my heart

I will give you sanctuary
Everything is safe with me
You have got a hold of my heart

01.28.11

How Stimulus “Works”

Posted in 銀行 / Banking, 政治 / Politics, 企業 / Business at 15:58

There’s an interesting joke going around in email. I wanted to write a reply to it because even though it is a joke, a lot of people believe that this is how stimulus works, and even those that do take it as a joke may not fully understand why it is funny.

The joke:

The streets are quiet in Smalltown, USA, where times are tough and everyone is in debt. A tourist stops at the motel, lays a $100 bill on the counter, and proceeds to inspect the rooms upstairs to pick one for the night.

With cash in hand the hotel owner runs to pay his $100 bill debt to the butcher.

The butcher immediately pays his $100 debt to the pig farmer.

The pig farmer pays his $100 debt to the feed supplier.

The feed supplier pays his $100 debt to the town hooker.

She then quickly pays the hotel owner her $100 room debt.

Promptly, the hotel owner returns the $100 bill to the counter so the tourist will not suspect anything, and moments later the tourist returns stating that the rooms are not satisfactory, picks up the $100 bill and leaves.

No one produced anything, no one earned anything, but the whole town is now out of debt and looking to the future with a lot more optimism.

……..and that, ladies and gentlemen, is how a “stimulus package” can improve the economy.

The main problem with this example is that none of these people were in debt. They each owed $100 and were owed $100. In accounting terms, their assets and liabilities canceled each other out. At worst they may have been worried that they might not be paid back.

The secondary problem is that this isn’t really how stimulus works. Stimulus is about increasing, not reducing debt. Here is more like what really happens:

The Congress and President pass a giant spending bill to stimulate the economy.

The Treasury doesn’t have enough revenue coming in to pay for it all right now, so needs to borrow (issue bonds).

The borrowing would exceed the debt ceiling, so the Treasury has to ask Congress to increase their credit limit. (They are going to hit this limit sometime between March and May according to estimates.)

Congress and the President increase the debt ceiling.

The Treasury issues new bonds, but it turns out that there isn’t enough demand to buy bonds. If demand for bonds is low, the price for bonds will decline. When bond prices are low, their yield is high; effectively the borrowing cost (interest) is increased.

If the government’s borrowing cost is too high, they can’t spend as much on stimulus, or they would need to increase borrowing even more to make up for getting less for each bond they sell. This isn’t any good for them, so they go to the Federal Reserve to ask for help.

The Federal Reserve is happy to oblige by helping out buying up bonds, thereby increasing their demand, increasing bond prices, and reducing yield. However, the money used to buy these bonds is created out of thin air, and instead of buying from the Treasury directly, they buy from specialized Wall Street government bond dealers who earn a nice commission on the deal. This is Quantitative Easing.

The money raised is then spent on a lot of different things, many of which are inefficient and non-productive. As this money works its way through the economy, demand for certain goods is increased, and many people begin to believe that things are getting better.


But this isn’t the end of the story. The larger quantity of money in the economy increases demand and therefore also pushes up prices, causing inflation. It is the explicitly stated goal of the Federal Reserve to have inflation of 2% per year. Or to put it more bluntly, right when people are having trouble paying their bills, they want everything to get more expensive.

Next, the government has to figure out what to do about all this debt they’ve built up. They have to do some combination of three things: 1) roll over the debt, 2) hope that inflation makes the debt more manageable or 3) collect more in taxes.

Rolling over the debt just kicks the can down the street. Next time the problem will just be bigger. Actually what they are hoping is that the economy will improve and people will forget about the problem. Government debt rarely gets paid down in good times.

The only way inflation will help to ease the debt problem would also end up destroying people’s savings and de facto reducing their income, as wages rarely keep up with inflation.

And then we come to taxes. Don’t worry, it’s only the rich that’ll have to pay the bill! And guess what? It’s the hotel owner, butcher, pig farmer and feed supplier in the example who are the rich capitalists who are expected to pay the bill. (The hooker isn’t exactly paying taxes on her income.)

Maybe they made enough out of the stimulus to pay these taxes. But they also have to pay higher prices for their goods, their employees are clamoring for cost-of-living raises, their profits are being squeezed (if they aren’t losing money) and their other investment income is flat because interest rates are being held down. And how are they supposed to “expand the economy” when they know there’s going to be a big tax bill due?

Oh right, they could borrow money to expand because interest rates are so low. Debt, debt, and more debt. The government borrows more, companies borrow more, consumers add more and more to their credit card bills and mortgages, and everyone’s debt keeps climbing higher and higher. Eventually this needs to be paid back. How does this happen? It’s supposedly because the economy will spontaneously roar back into action, but all I see is steadily increasing debt.


Getting back to the original story, no one produced anything, and no one earned anything. Maybe they feel a little better now that they don’t have to worry if they will be paid back what they were owed. But they also have no efforts wasted on inefficient and non-productive government projects, they don’t have any inflation, they don’t have increased government debt, and they don’t have a big tax bill looming. The story correctly assumes that the people in it are—or at least feel—better off by not being in debt, but actual stimulus increases, not reduces overall debt.

Also in the story, let’s assume the worst case: everyone defaults on their debts. What is the result? Well, everyone will be pissed off at each other for a while for ripping them off, but in reality the result is exactly the same: each person no longer owes any money and is no longer owed any money. The $100 that enters the economy is also almost immediately withdrawn from the economy with no cost involved. In reality, the money supply is increased through expansion of lending, so there is always an interest cost, and decreasing the money supply is avoided at all costs for fear of causing deflation.


Back in the real world, I said above that government has three ways to handle this. There’s actually a fourth way, but nobody likes it. That way is to reduce spending and pay down the debt until things are more manageable. Yes, this is painful, but everyone gets out of it without a huge debt and big tax bill looming.

The history of trying to stimulate the economy is not an encouraging one. From the Great Depression to 1970s stagflation to Japan’s Lost Decade (now entering its third decade!), the track record of government stimulus is one of long drawn out periods of stagnation with some combination of high unemployment, inflation, and mounting debt levels. The only answer the stimulistas have to these failures is that there wasn’t enough stimulus, and in any case it would have been worse if nothing had been done.

Real economic growth happens when people produce good quality products that others want to buy, when clever people figure out ways to make things that are better and/or less expensive and when people invest in capital goods because there is a market for what they produce. But all of this has to be real activity without the extra hidden costs of stimulus.

The debate is really about two ways of dealing with an economic problem. You could stop doing what isn’t working, pay the bill and move on with the problem behind you. Or you can borrow and hope the problem eventually goes away, and meanwhile you have to keep paying more and more as the debt piles up around you.

06.04.10

VPS Migration

Posted in 電腦 / Computers, 軟體 / Software at 00:29

Tonight I migrated my VPS from vpslink which I no longer recommend to GeekStorage. They both run Debian on OpenVZ/Virtuozzo, so I figured it wouldn’t be hard to migrate over.

I didn’t really find much about migration on the user side. Most of the migration pages were about how to migrate containers from the host server’s perspective. I did manage to cobble together enough clues to figure out what to do.

Basically to summarize the essential points, you can just copy everything from the old server to the new, clobbering whatever is there, EXCEPT for the following:

/aquota.group
/aquota.user
/etc/fstab
/etc/hostname
/etc/hosts
/etc/resolv.conf
/etc/network/interfaces
/etc/network/interfaces.template
/dev
/proc
/sys

In more detail:

On vpslink I have Debian on OpenVZ. So when I signed up the GeekStorage, I requested Debian on Virtuozzo. OpenVZ is the open-source variety of Virtuozzo, so they are close enough.

When GeekStorage said the VPS was ready, I logged in and used rsync to copy everything from the old server to /backup/old. That took a few hours. Then on the old server, I shutdown all the services (sendmail, apache, mysql, tinymuck, etc.) and then ran rsync again. That updated everything that changed while the first rsync was running, and was fairly quick.

Once that was done, I put the server in repair mode. This creates a temporary container with the real container’s contents mounted under /repair. I logged into the repair mode serve. First I moved everything in /repair except aquota.*, backup, dev, proc and sys to /repair/backup/orig. This moves the new VPS’ original OS files out of the way.

Then I moved everything in /repair/backup/old except aquota.*, dev, proc and sys to /repair. That moves the old VPS’ OS files to the new VPS’ root directory. Then I copied the etc files (see above) from /repair/backup/orig/etc to /repair/etc.

Caveats: Remember that there are probably hidden dotfiles in the old and new root dirs you need to move too. Also remember to always work in /repair when in repair mode. It’s easy to forget and start twiddling in /etc instead of /repair/etc. That disappears as soon as repair mode is finished.

Then I took the server out of repair mode, which boots into the VPS container again. And miraculously, it booted up just fine with everything looking just like it was on the old VPS. I had to twiddle a couple of other files with hardcoded IPs, but the OS came up just fine. I also had to update a bunch of things in DNS and wait for DNS caching to time out.

03.04.10

Posted in 沒有類 / Uncategorized at 03:22

郭泓志 Hong-Chih Kuo Subway Taiwan 30s Ad

02.14.10

Tweet! Tweet!

Posted in 沒有類 / Uncategorized at 03:01

Automatically shipped by LoudTwitter

02.10.10

Tweet! Tweet!

Posted in 沒有類 / Uncategorized at 03:00

  • 12:44 is enjoying this very nice weather, but stuck in a meeting this afternoon. #

Automatically shipped by LoudTwitter

02.08.10

Tweet! Tweet!

Posted in 沒有類 / Uncategorized at 03:00

Automatically shipped by LoudTwitter