Month: February 2013

Analyzing the mtDNA of descendants of Richard III’s mother

(Followup to my previous post about Richard III’s mtDNA.)

When I posted earlier today, I was aware that Joy and Michael Ibsen who are descendants of Richard III’s mother and who would share the same mtDNA sequence had been tested as being in haplogroup J. At the time, I was unaware of and had not been able to find more details about their DNA tests.

It turns out that some details of Joy Ibsen’s test had been published in the book The Last Days of Richard III by John Ashdown-Hill (Kindle link; hardcover and paperback also available) published in 2010. Helen Riding was kind enough to post the results to facebook:

This isn’t a full sequence, and only a subset of HVR1 and HVR2 were sequenced, but this gets us 682bp of sequence, significantly better than the 53bp we have for Richard III. (There are two sequencing results because it was sequenced twice by separate labs.)

So let’s see what this reveals to us in mthap. First, let’s convert that table to a format usable by mthap and save that to a file:

16069T 16126C
73G 146C 185A 188G 263G 295T 315.1C

Next we’ll again visit the advanced options page because the HVR1 and HVR2 ranges weren’t fully sequenced. This time we want to check HVR1 and enter positions 16020-16390 and check HVR2 and enter positions 58-367. After clicking “Upload” and waiting 10-15 seconds we get this result:

Based on this, Joy Ibsen’s haplogroup is most likely J1c2c. J1c2 is pretty definite. J1c2c is based on optional marker 146C, but since we’re already pretty sure about J1c2, then J1c2c is also a good bet. According to Behar et. al. 2012 the estimated age for this haplogroup is about 4543 years old. J1c2c2 and J1c2c2a are also possibilities but the defining markers are not included in the sequence. (UPDATE 2: J1c2c1 is also possible; see below.) Note that 228A is missing, but it is an optional marker because reversions are very common within J1c.

Now, this isn’t Richard III’s sequence, but I would assume that they wouldn’t be so certain about the DNA matching if they didn’t already know it at least matched this much. Therefore it is likely that Richard III was also J1c2c. We’ll have to wait for more details on his sequence to be released to be sure.

UPDATE: This Science News article also says that Ibsen and the Richard III remains are J1c2c.

UPDATE 2: The above originally omitted J1c2c1 as a possibility due to lack of the 222T marker. Based on Ian Logan’s observations, 222T is an unstable marker prone to reversion, so lack of this marker is not necessarily significant. J1c2c1a would still be excluded.

Analyzing the mtDNA of the presumed Richard III skeleton with mthap

I thought it would be fun to try analyzing the mtDNA sequence of the presumed Richard III skeleton using my mthap program to see what it comes up with.

Unfortunately, only a 53bp fragment of the ~16569bp mtDNA sequence has been released so far, via this image on the University of Leicester web site:

Richard III mtDNA fragment

(Click for full size.)

This has been transcribed thanks to Ann Turner and Dave Cissell on the ISOGG list as:

CAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGCA

This covers the sequence from positions 16076 to 16127 relative to the rCRS or RSRS reference sequences. (The position numbers on the image are presumably offset due to an earlier insertion.) The only difference to rCRS in the sequence is 16126C. That’s not a lot to work with. Even a basic HVR1 mtDNA test covers over 500 positions sequenced and can still be highly ambiguous. These days a solid haplogroup assignment requires a full sequence, or at least a genotype test covering thousands of markers across the full sequence to get you close (e.g. Genographic 2.0 or 23andMe).

But let’s see how far this gets us anyways.

Published reports indicate that Michael Ibsen, a descendant of Richard III’s mother is in haplogroup J but doesn’t get more specific. 16126C is one of the defining markers for the parent group JT, but it is also found in 11 other haplogroups in the current PhyloTree Build 15 reference. One of the defining markers for J is 16069T, but regrettably the image cuts off just a few bp shy of that marker, so at best this fragment can show JT, but not J.

We’d next want to go through the other 11 possible haplogroups to see which ones fit our fragment and which don’t. In other words, we’d want to look for which of these haplogroups have 16126C but not any other marker in the range of 16076 to 16127. We could do this manually, but that’s what computers are for, so let’s try to do this in an automated way.

I have a web application I’ve written called mthap which is freely available to use for analyzing mtDNA results. The basic version is very easy to use. Just feed it your data file and look at the results. That makes a lot of assumptions though, assumptions which don’t work well with a short fragment like this. Those assumptions are based on the most common DTC mtDNA tests. There’s also the less well known advanced options page where you can twiddle various parameters for unusual cases like this.

Here’s what we need to do:

  1. Make a text file with a text editor such as notepad with this content: 16126C
  2. Select this file on the “File:” line.
  3. Tick the HVR1 option.
  4. Enter 16076 to 16127 as the HVR1 positions.
  5. Click “Upload”

After waiting 10-15 seconds you will see the results. Due to the limitations of this sample, we get a lot of potential matches, but the first four are the most significant: H14b1, HV0a1, R0a, and finally JT. The rest are all either poor matches or subgroups of these. So we’ve managed to reduce our possibilities from 11 to 4, which is not bad. But we’re still left with a good deal of ambiguity. Presumably we will get a full sequence or at least a longer sequence once the scientific journals publish the full articles on the analysis.

UPDATE: See also the followup article: Analyzing the mtDNA of descendants of Richard III’s mother.

(Please note that this is not meant to cast doubt on the identification. It is merely to show how much objective data we can determine based on the currently released information.)